This commit is contained in:
DavidOnTop 2025-04-10 14:31:27 +02:00
parent 27c33e1992
commit 5e7b7a2c01
Signed by: DavidOnTop
GPG key ID: 8D3E9A75E3E13D89
20 changed files with 298 additions and 219 deletions

View file

@ -4,12 +4,15 @@ pub fn main() {
v.push(rand::random::<f32>() * 40.0 - 20.0);
}
v.sort_by(|a, b| a.partial_cmp(b).unwrap());
println!("{:?}", v);
let mut input = String::new();
println!("zadajte cislo");
std::io::stdin().read_line(&mut input).unwrap();
let input: f32 = input.trim().parse().unwrap();
println!("{}", v.iter().position(|x| *x == input).unwrap_or(usize::MAX))
println!(
"{}",
v.iter().position(|x| *x == input).unwrap_or(usize::MAX)
)
}

View file

@ -8,6 +8,16 @@ pub fn main() {
panic!("Invalid input");
}
let mut input = input.to_lowercase();
input = input.chars().enumerate().map(|(i, c)| if i == 0 { c.to_uppercase().next().unwrap() } else { c }).collect();
input = input
.chars()
.enumerate()
.map(|(i, c)| {
if i == 0 {
c.to_uppercase().next().unwrap()
} else {
c
}
})
.collect();
println!("{}", input);
}

View file

@ -4,18 +4,19 @@ pub fn main() {
let mut input = String::new();
std::io::stdin().read_line(&mut input).unwrap();
match input.trim() {
"1." | "1" | "mtokm" => read_and_convert(|u| {u * 1.609344}),
"2." | "2" | "kmtom" => read_and_convert(|u| {u / 1.609344}),
"1." | "1" | "mtokm" => read_and_convert(|u| u * 1.609344),
"2." | "2" | "kmtom" => read_and_convert(|u| u / 1.609344),
_ => {}
}
}
fn read_and_convert<F>(tom: F)
where F: Fn(f64) -> f64
where
F: Fn(f64) -> f64,
{
println!("zadaj udaj");
let mut input = String::new();
std::io::stdin().read_line(&mut input).unwrap();
let unit: f64 = input.trim().parse().unwrap();
println!("{}", tom(unit));
}
}

View file

@ -7,8 +7,17 @@ pub fn main() {
teploty.push(rand.gen::<f64>() * 40.0 - 20.0);
}
println!("teploty: {:?}", teploty);
println!("najnizsia {}", teploty.iter().map(|e| e.clone()).reduce(f64::min).unwrap());
println!("najvizsia {}", teploty.iter().map(|e| e.clone()).reduce(f64::max).unwrap());
println!(
"najnizsia {}",
teploty.iter().map(|e| e.clone()).reduce(f64::min).unwrap()
);
println!(
"najvizsia {}",
teploty.iter().map(|e| e.clone()).reduce(f64::max).unwrap()
);
println!("priemer {}", teploty.iter().sum::<f64>() / 20.0);
println!("pocet nulovych teplot: {}", teploty.iter().find(|e| **e == 0.0).iter().count())
println!(
"pocet nulovych teplot: {}",
teploty.iter().find(|e| **e == 0.0).iter().count()
)
}

View file

@ -14,7 +14,7 @@ pub fn main() {
.parse()
.expect("ocakavali sme prirodzene cislo");
input.clear();
println!("Cisla delitelne tromi v intervale od {} do {}", a, b);
devidable(a, b);

View file

@ -2,9 +2,15 @@ static DNA: &'static str = "AACTATTTCGGGGGGCGAGCCCTCATCGTCTCTTCTGCGGATGACTCAACAC
static DNAMUT: &'static str = "AACTATGTCGCGAGGCGAGCTCTCATCGTCTCGTCTGCGGATGACTCCACACGCTAGCGACGTGAAGTCGAATCCGTCGATGGTTATAAATCAGAGACTCAGAGTGCTGTCTGGAGCGTGAATCTAACGGTACGTATCTCGATAGCTCGGTCGCTTTTCGCACTCCGCGAAAGTTCGTACCGCTCATACACTAGGTTGCGAAGCCTATGCTGATATATGAATCCACACTAGAGCAGTGCTCTTAAGAATCGCAGTTGTAAATACTTAATACTCCAATCGGCTTTTACGTGCACCACCGCGCGCGGCTGACAAGGGTCTCACATCGGGAAACAAGACAGTTCCGGGCTGGAAGTAGCGCCGGCTAAGGAAGACGCCTGGTACGGCAGGACTATGAAACCAGTACAAAGGCAACATCCTCACTTGGGTGAACGGAAACGCAGTATTATGGTTACTTCCTGGATACGTGAAACATATCCCATGGTAGTCCTTAGACTTGGGAGTCTATCACCCCTAGGGCCCATATCTGGAGATAGACGCCAGGTTGAATCCGTATTTGGAGGTACGATGGAACAGTCTGGGTGGGACGTGCTTCATTTATACCCTGCGCAGGCTGGACCGAGGACCGCAAGGTGCGGCGGTGCACAAGCAATTGACAACTAACCACCGTGTATTCATTATGGTACCAGGAACTTTAAGCCGAGTCAATGAAGCTCGCATTACAGTGTGTACCGCATCTTGCCGTTACTCACACACTGTGATCCACCACAAGTCAAGCCATTGCCTCTCTGACACGCCGTAAGAATTAATATGTAAACTTTGCGCGGGTTGACTGCGATCCGTTCAGTCTCGTCCGAGGGCACAATCCTATTCCCATTTGTATGTTCAGCTAACTTCTACCCATCCTCTGAAGTTAAGTAGGTCGTGAGATGCCATGGAGGCTCTCGTTCATCCCGTGGGACATCAAGCTTCCCCTTGATAAAGCACCCCGCTCGGGTGTAAA";
pub fn main() {
DNA.chars().zip(DNAMUT.chars()).enumerate().for_each(|(i, (d, m))| {
if (d != m) {
println!("Mutacia nastala na {} pozicii povodna {d}, nova {m}", i + 1)
}
})
DNA.chars()
.zip(DNAMUT.chars())
.enumerate()
.for_each(|(i, (d, m))| {
if (d != m) {
println!(
"Mutacia nastala na {} pozicii povodna {d}, nova {m}",
i + 1
)
}
})
}

View file

@ -1,7 +1,7 @@
pub fn main() {
for i in 1..5 {
for j in 0..10 {
println!("{i}{j}{i}")
}
}
for i in 1..5 {
for j in 0..10 {
println!("{i}{j}{i}")
}
}
}

View file

@ -1,19 +1,19 @@
pub fn main() {
println!("Zadaj cislo a znacku (F/C)");
let mut input = String::new();
std::io::stdin().read_line(&mut input).unwrap();
let mut input = input.trim().to_string();
let unit = input.remove(input.len() - 1);
let num: f64 = input.parse().expect("Neda sa retazec premenit na cislo");
match unit {
'C' | 'c' => {
println!("{}F", num * 1.8 + 32.0)
}
'F' | 'f' => {
println!("{}C", (num - 32.0)/1.8)
}
_ => {
println!("nepodporovana znacka")
}
}
println!("Zadaj cislo a znacku (F/C)");
let mut input = String::new();
std::io::stdin().read_line(&mut input).unwrap();
let mut input = input.trim().to_string();
let unit = input.remove(input.len() - 1);
let num: f64 = input.parse().expect("Neda sa retazec premenit na cislo");
match unit {
'C' | 'c' => {
println!("{}F", num * 1.8 + 32.0)
}
'F' | 'f' => {
println!("{}C", (num - 32.0) / 1.8)
}
_ => {
println!("nepodporovana znacka")
}
}
}

View file

@ -1,15 +1,15 @@
static SAM: &str = "aeiyou";
pub fn main() {
let mut input = String::new();
println!("Zadaj slovo");
std::io::stdin().read_line(&mut input).unwrap();
let mut input = input.trim().to_string();
if SAM.contains(input.chars().next().expect("Slovo musi mat aspon 1 znak")) {
println!("{input}way")
} else {
let c = input.chars().next().unwrap();
input.replace_range(0..1, "");
println!("{input}{c}ay")
}
let mut input = String::new();
println!("Zadaj slovo");
std::io::stdin().read_line(&mut input).unwrap();
let mut input = input.trim().to_string();
if SAM.contains(input.chars().next().expect("Slovo musi mat aspon 1 znak")) {
println!("{input}way")
} else {
let c = input.chars().next().unwrap();
input.replace_range(0..1, "");
println!("{input}{c}ay")
}
}

View file

@ -1,14 +1,14 @@
static SAM: &str = "aeiyouáéíóúý";
pub fn main() {
let mut input = String::new();
println!("Zadaj vetu");
std::io::stdin().read_line(&mut input).unwrap();
let mut input = input.trim().to_string();
for c in SAM.chars() {
input = input.replace(c, "_");
}
println!("{input}");
let mut input = String::new();
println!("Zadaj vetu");
std::io::stdin().read_line(&mut input).unwrap();
let mut input = input.trim().to_string();
for c in SAM.chars() {
input = input.replace(c, "_");
}
println!("{input}");
}

View file

@ -2,60 +2,59 @@ use std::error::Error;
use std::fmt::{Debug, Display, Formatter};
pub fn main() {
let mut input1 = String::new();
println!("Zadaj 1 retazec DNA");
std::io::stdin().read_line(&mut input1).unwrap();
let input1 = input1.trim().to_uppercase().to_string();
let mut input2 = String::new();
println!("Zadaj 2 complementarny retazec DNA");
std::io::stdin().read_line(&mut input2).unwrap();
let input2 = input2.trim().to_uppercase().to_string();
let mut input1 = String::new();
println!("Zadaj 1 retazec DNA");
std::io::stdin().read_line(&mut input1).unwrap();
let input1 = input1.trim().to_uppercase().to_string();
let mut input2 = String::new();
println!("Zadaj 2 complementarny retazec DNA");
std::io::stdin().read_line(&mut input2).unwrap();
let input2 = input2.trim().to_uppercase().to_string();
let n_chyb = pocet_chyb(input1.clone(), input2.clone()).unwrap();
println!("Pocet chyb: {n_chyb}");
println!("Percento chyb: {}", percento_chyb(input1.clone(), input2));
println!("Complementarny retazec: {}", generuj_retazec(input1));
let n_chyb = pocet_chyb(input1.clone(), input2.clone()).unwrap();
println!("Pocet chyb: {n_chyb}");
println!("Percento chyb: {}", percento_chyb(input1.clone(), input2));
println!("Complementarny retazec: {}", generuj_retazec(input1));
}
#[derive(Default, Debug)]
struct LengthError(String);
impl Display for LengthError {
fn fmt(&self, f: &mut Formatter<'_>) -> std::fmt::Result {
std::fmt::Display::fmt(&self.0, f)
}
fn fmt(&self, f: &mut Formatter<'_>) -> std::fmt::Result {
std::fmt::Display::fmt(&self.0, f)
}
}
impl Error for LengthError {}
fn pocet_chyb(i1: String, i2: String) -> Result<usize, LengthError> {
if i1.len() != i2.len() {
return Err(LengthError("Dna a complementarne dna niesu rovnako dlhe".to_string()))
}
let mut n: usize = 0;
i1.chars().zip(i2.chars()).for_each(|cp| {
match cp {
('A', 'T') | ('T', 'A') | ('C', 'G') | ('G', 'C') => (),
_ => n += 1
}
});
Ok(n)
if i1.len() != i2.len() {
return Err(LengthError(
"Dna a complementarne dna niesu rovnako dlhe".to_string(),
));
}
let mut n: usize = 0;
i1.chars().zip(i2.chars()).for_each(|cp| match cp {
('A', 'T') | ('T', 'A') | ('C', 'G') | ('G', 'C') => (),
_ => n += 1,
});
Ok(n)
}
fn percento_chyb(i1: String, i2: String) -> f64 {
let n_chyb = pocet_chyb(i1.clone(), i2).unwrap();
(n_chyb as f64 / i1.len() as f64) * 100f64
let n_chyb = pocet_chyb(i1.clone(), i2).unwrap();
(n_chyb as f64 / i1.len() as f64) * 100f64
}
fn generuj_retazec(i1: String) -> String {
i1.chars().map(|c| {
match c {
'A' => 'T',
'T' => 'A',
'C' => 'G',
'G' => 'C',
_ => ' ',
}
}).collect()
}
i1.chars()
.map(|c| match c {
'A' => 'T',
'T' => 'A',
'C' => 'G',
'G' => 'C',
_ => ' ',
})
.collect()
}

View file

@ -2,17 +2,30 @@ use std::fs::OpenOptions;
use std::io::Write;
pub fn main() {
let mut file = OpenOptions::new().create(true).truncate(true).write(true).open("./cisla.txt").unwrap();
let mut cisla = Vec::with_capacity(21);
for i in 0..20 {
let mut input = String::new();
println!("Zadaj cislo {} z 20", i + 1);
std::io::stdin().read_line(&mut input).unwrap();
let inp: f64 = input.trim().parse().unwrap();
cisla.push(inp);
}
let avg = cisla.iter().sum::<f64>() / 20f64;
println!("priemer: {avg}");
cisla.push(avg);
file.write_all(cisla.iter().map(|f| f.to_string()).collect::<Vec<String>>().join("\n").as_bytes()).unwrap()
let mut file = OpenOptions::new()
.create(true)
.truncate(true)
.write(true)
.open("./cisla.txt")
.unwrap();
let mut cisla = Vec::with_capacity(21);
for i in 0..20 {
let mut input = String::new();
println!("Zadaj cislo {} z 20", i + 1);
std::io::stdin().read_line(&mut input).unwrap();
let inp: f64 = input.trim().parse().unwrap();
cisla.push(inp);
}
let avg = cisla.iter().sum::<f64>() / 20f64;
println!("priemer: {avg}");
cisla.push(avg);
file.write_all(
cisla
.iter()
.map(|f| f.to_string())
.collect::<Vec<String>>()
.join("\n")
.as_bytes(),
)
.unwrap()
}

View file

@ -2,14 +2,19 @@ use std::fs::OpenOptions;
use std::io::Write;
pub fn main() {
let mut input = String::new();
println!("Zadaj diktat");
std::io::stdin().read_line(&mut input).unwrap();
let input = input.trim().to_string();
let povodny_pocet = input.clone().chars().filter(|c| *c == '_').count();
let diktat = input.replace(['i', 'í', 'y', 'ý'], "_");
let mut file = OpenOptions::new().create(true).truncate(true).write(true).open("./doplnovacka.txt").unwrap();
file.write_all(diktat.clone().as_bytes()).unwrap();
let max = diktat.chars().filter(|c| *c == '_').count() - povodny_pocet;
println!("Max pocet chyb: {}", max);
let mut input = String::new();
println!("Zadaj diktat");
std::io::stdin().read_line(&mut input).unwrap();
let input = input.trim().to_string();
let povodny_pocet = input.clone().chars().filter(|c| *c == '_').count();
let diktat = input.replace(['i', 'í', 'y', 'ý'], "_");
let mut file = OpenOptions::new()
.create(true)
.truncate(true)
.write(true)
.open("./doplnovacka.txt")
.unwrap();
file.write_all(diktat.clone().as_bytes()).unwrap();
let max = diktat.chars().filter(|c| *c == '_').count() - povodny_pocet;
println!("Max pocet chyb: {}", max);
}

View file

@ -1,28 +1,27 @@
pub fn main() {
let mut input1 = String::new();
std::io::stdin().read_line(&mut input1).unwrap();
let input1 = input1.trim().parse().unwrap();
let mut input2 = String::new();
std::io::stdin().read_line(&mut input2).unwrap();
let input2 = input2.trim().parse().unwrap();
let res = max(input1, input2);
if let Some(res) = res {
println!("{res}")
} else {
println!("rovnake")
}
let mut input1 = String::new();
std::io::stdin().read_line(&mut input1).unwrap();
let input1 = input1.trim().parse().unwrap();
let mut input2 = String::new();
std::io::stdin().read_line(&mut input2).unwrap();
let input2 = input2.trim().parse().unwrap();
let res = max(input1, input2);
if let Some(res) = res {
println!("{res}")
} else {
println!("rovnake")
}
}
pub fn max(i1: i32, i2: i32) -> Option<i32> {
let res = (i1.to_string().len(), i2.to_string().len());
if res.0 == res.1 {
None
} else if res.0 > res.1 {
Some(i1)
} else {
Some(i2)
}
let res = (i1.to_string().len(), i2.to_string().len());
if res.0 == res.1 {
None
} else if res.0 > res.1 {
Some(i1)
} else {
Some(i2)
}
}

View file

@ -1,7 +1,7 @@
pub fn main() {
let mut sutaziaci = vec![("aoeu", 21), ("htns", 25), ("pyfg", 16)];
sutaziaci.sort_by(|s, l| {s.1.cmp(&l.1)});
sutaziaci.iter().for_each(|n| {
println!("{} {}", n.0, n.1);
})
let mut sutaziaci = vec![("aoeu", 21), ("htns", 25), ("pyfg", 16)];
sutaziaci.sort_by(|s, l| s.1.cmp(&l.1));
sutaziaci.iter().for_each(|n| {
println!("{} {}", n.0, n.1);
})
}

View file

@ -1,27 +1,29 @@
pub fn main() {
println!("Prve cislo: ");
let mut num = String::new();
std::io::stdin().read_line(&mut num).unwrap();
let num: f64 = num.trim().parse().unwrap();
println!("Prve cislo: ");
let mut num = String::new();
std::io::stdin().read_line(&mut num).unwrap();
let num: f64 = num.trim().parse().unwrap();
println!("operator: ");
let mut operand = String::new();
std::io::stdin().read_line(&mut operand).unwrap();
let operand = operand.trim().to_string();
println!("operator: ");
let mut operand = String::new();
std::io::stdin().read_line(&mut operand).unwrap();
let operand = operand.trim().to_string();
println!("Druhe cislo: ");
let mut num1 = String::new();
std::io::stdin().read_line(&mut num1).unwrap();
let num1: f64 = num1.trim().parse().unwrap();
let operator = match operand.as_str() {
"+" => {|c1: f64, c2: f64| {c1 + c2}}
"-" => {|c1: f64, c2: f64| {c1 - c2}}
"*" => {|c1: f64, c2: f64| {c1 * c2}}
"/" => {|c1: f64, c2: f64| {c1 / c2}}
_ => {panic!("Zly operator")}
};
let result = operator(num, num1);
println!("Vysledok {result}");
}
println!("Druhe cislo: ");
let mut num1 = String::new();
std::io::stdin().read_line(&mut num1).unwrap();
let num1: f64 = num1.trim().parse().unwrap();
let operator = match operand.as_str() {
"+" => |c1: f64, c2: f64| c1 + c2,
"-" => |c1: f64, c2: f64| c1 - c2,
"*" => |c1: f64, c2: f64| c1 * c2,
"/" => |c1: f64, c2: f64| c1 / c2,
_ => {
panic!("Zly operator")
}
};
let result = operator(num, num1);
println!("Vysledok {result}");
}

View file

@ -1,13 +1,13 @@
pub fn main() {
println!("Zaklad");
let mut inp = String::new();
std::io::stdin().read_line(&mut inp).unwrap();
let inp: f64 = inp.trim().parse().unwrap();
println!("mocnitel: ");
let mut n = String::new();
std::io::stdin().read_line(&mut n).unwrap();
let n: f64 = n.trim().parse().unwrap();
println!("vysledok: {}", inp.powf(n))
println!("Zaklad");
let mut inp = String::new();
std::io::stdin().read_line(&mut inp).unwrap();
let inp: f64 = inp.trim().parse().unwrap();
println!("mocnitel: ");
let mut n = String::new();
std::io::stdin().read_line(&mut n).unwrap();
let n: f64 = n.trim().parse().unwrap();
println!("vysledok: {}", inp.powf(n))
}

View file

@ -1,16 +1,32 @@
pub fn main() {
println!("pocet ziakov: ");
let mut num = String::new();
std::io::stdin().read_line(&mut num).unwrap();
let num: usize = num.trim().parse().unwrap();
let mut ziaci = Vec::with_capacity(num);
for i in 0..num {
println!("Zadaj ziaka {i}, vo formate: meno priezvisko, trieda, znamka znamka znamka znamka znamka");
let mut input = String::new();
std::io::stdin().read_line(&mut input).unwrap();
let input = input.trim().split(",").map(|s| {s.trim().to_string()}).collect::<Vec<_>>();
ziaci.push((input[0].clone(), input[1].clone(), input[2].clone().split(" ").map(|z| {z.parse::<i32>().unwrap()}).collect::<Vec<_>>()));
}
let ziaci = ziaci.iter().map(|z| (z, z.2.iter().sum::<i32>() as f64 / 5.0)).collect::<Vec<_>>().sort_by(|z, e| {z.1.partial_cmp(&e.1)});
println!("pocet ziakov: ");
let mut num = String::new();
std::io::stdin().read_line(&mut num).unwrap();
let num: usize = num.trim().parse().unwrap();
let mut ziaci = Vec::with_capacity(num);
for i in 0..num {
println!("Zadaj ziaka {i}, vo formate: meno priezvisko, trieda, znamka znamka znamka znamka znamka");
let mut input = String::new();
std::io::stdin().read_line(&mut input).unwrap();
let input = input
.trim()
.split(",")
.map(|s| s.trim().to_string())
.collect::<Vec<_>>();
ziaci.push((
input[0].clone(),
input[1].clone(),
input[2]
.clone()
.split(" ")
.map(|z| z.parse::<i32>().unwrap())
.collect::<Vec<_>>(),
));
}
let ziaci = ziaci
.iter()
.map(|z| (z, z.2.iter().sum::<i32>() as f64 / 5.0))
.collect::<Vec<_>>()
.sort_by(|z, e| z.1.partial_cmp(&e.1).unwrap());
}

View file

@ -1,9 +1,11 @@
pub fn main() {
rec(7)
rec(7)
}
fn rec(num: i32) {
if num >= 1000 {return;}
println!("num: {num}");
rec(num + 7)
if num >= 1000 {
return;
}
println!("num: {num}");
rec(num + 7)
}

View file

@ -1,20 +1,34 @@
pub fn main() {
let ziaci = ["Horák Marek","Gajdáč Tibor","Velická Barbora","Malík Peter","Malíková Diana"];
let ziaci = [
"Horák Marek",
"Gajdáč Tibor",
"Velická Barbora",
"Malík Peter",
"Malíková Diana",
];
let hodiny= [15,0,0,75,34];
let hodiny = [15, 0, 0, 75, 34];
println!("Vsetky vymeskane hodiniy: {}", hodiny.iter().sum::<i32>());
println!("Priemerny pocet vymeskanych hodin: {}", hodiny.iter().sum::<i32>() as f64 / hodiny.len() as f64);
let najhorsi = ziaci.iter().zip(hodiny).max_by(|z, e| {z.1.cmp(&e.1)});
if let Some(najhorsi) = najhorsi {
println!("Najhorsiu dochadzku ma: {} s dochadzkou {}", najhorsi.0, najhorsi.1)
} else {
println!("Nepodarilo sa najst najhorsieho")
}
let s0 = ziaci.iter().zip(hodiny).filter(|e| {e.1 == 0}).collect::<Vec<_>>();
println!("pocet ziakou ktori mozu mat pochvalu: {}", s0.len());
println!("Ziaci na pochvalu");
s0.iter().for_each(|e| {
println!(" {}", e.0)
});
println!("Vsetky vymeskane hodiniy: {}", hodiny.iter().sum::<i32>());
println!(
"Priemerny pocet vymeskanych hodin: {}",
hodiny.iter().sum::<i32>() as f64 / hodiny.len() as f64
);
let najhorsi = ziaci.iter().zip(hodiny).max_by(|z, e| z.1.cmp(&e.1));
if let Some(najhorsi) = najhorsi {
println!(
"Najhorsiu dochadzku ma: {} s dochadzkou {}",
najhorsi.0, najhorsi.1
)
} else {
println!("Nepodarilo sa najst najhorsieho")
}
let s0 = ziaci
.iter()
.zip(hodiny)
.filter(|e| e.1 == 0)
.collect::<Vec<_>>();
println!("pocet ziakou ktori mozu mat pochvalu: {}", s0.len());
println!("Ziaci na pochvalu");
s0.iter().for_each(|e| println!(" {}", e.0));
}